![]() Weve gathered more than 5 Million Images uploaded by our users and sorted them by the most popular ones. All links are active and fast □įollow our Spotify Playlist: loku.lnk. Explore a curated colection of Wallpaper Dont Touch My Phone Images for your Desktop, Mobile and Tablet screens. A few other trucks made brief appearances, including a classic 1967-1972 Chevy C-10.Please click the dowload button to start download Mp3. hate me You can call me crazy but Don't touch my truck Skrrt Skrrt Don't touch my truck Skrrt Skrrt Don't touch my truck Follow BRELAND. Next in the collection of trucks not to touch were two unlikely friends: a Suzuki Samurai and a lifted Chevy Suburban. I fully plan on givin ' this place my personal touch in due time. Buy this design or create your own original Keep. I don't know you nearly enough, ' he says, and then kisses me lightly. This truck also recurred throughout the duration of the video, spurting fire out its tailpipe and straight up the bedside. For about 2 months now whenever I start my truck there is a loud knocking noise that sounds like someones knocking on the back. Another original poster design created with the Keep Calm-o-matic. Here’s the problem: Fuel separators aren’t. While it’s not good to get water in your diesel tank, a fuel separator system will usually catch water before it gets too far into your fuel system and cause serious damage. Then, Breland continued his country-rap in front of a 1988-1998 Chevy truck done up sport-truck style, throwing flames out of the side-exit exhaust. DEF is a mixture of water and urea, that sort of smells like a barnyard stuff that’s used in a lot of fertilizers. It looked like a Sema truck, but we can't be sure. Dont touch my phone or dont touch phone privacy uses your phones touch sensors. This mobile touch app has some strong answers again snoopers or snooper. So who touched my phone or please dont touch my phone are the days gone. Next, a brand new big ol' lifted Ram 1500 did some donuts in a dirt field. Like Repost Share Copy Link Add to Next up Add to Next up Add to Next up Added. So you can catch mobile thefts and can catch mobile thieves with this mobile alarm touch app. ![]() While ever fiber of our being whispered don't do this, you're at work and that's no place for fun, we watched on. What in the world is going on? We were so confused at this point. After an intro in which Breland undoubtedly purposely tricked his viewers (just watch and see), Breland burst into frame and opened by saying, " Don't touch my truck." Immediately three tricked-out semitrucks entered the scene and came and went throughout the rest of the video.
0 Comments
and/or other countries.Ĭorporate Responsibility, Privacy & Legal Notices: Compass is a licensed real estate broker, licensed to do business as Compass RE in Delaware, Idaho, New Jersey, Pennsylvania and Tennessee, Compass Real Estate in Washington, DC, Wyoming and Idaho, Compass Realty Group in Missouri and Kansas, and Compass South Carolina LLC in South Carolina. ![]() Terms of Service, Privacy Policy, Responsible Disclosure, Compass is an E-Verify employer, Notice for California Applicants, and California COVID-19 Rules of EntryĬOMPASS, the Compass logo, and other various trademarks, logos, designs, and slogans are the registered and unregistered trademarks of Compass, Inc. Information being provided is for consumers’ personal, non-commercial use and may not be used for any purposes other than to identify prospective properties consumers may be interested in purchasing. The Broker/Agent providing the information contained herein may or may not have been the Listing and/or Selling Agent. Unless otherwise specified in writing, the Broker/Agent has not and will not verify any information obtained from other sources. Information from sources other than the Listing Agent may have been included in the MLS data. Buyers are responsible for verifying the accuracy of all information and should investigate the data themselves or retain appropriate professionals. Information is provided for consumers’ personal, non-commercial use, and may not be used for any purpose other than to identify prospective properties consumers may be interested in purchasing. MLS data is deemed reliable but is not guaranteed accurate by the MLS. Listing Courtesy of Legacy Real Estate & Assoc, David Vigil, DRE #00922509īased on information from the San Francisco Association of Realtors as of 12:00 AM, the MLSListings MLS as of 12:00 AM, or the BAREIS MLS as of 12:00 AM. You are not required to use OriginPoint and are free to shop around and compare the terms of other providers. As Affiliates, any referral by one Affiliate to the other may provide the referring company, its affiliates, and/or their employees with a financial or other benefit. ![]() ![]() OriginPoint LLC is an affiliate of the Compass companies (OriginPoint LLC and Compass, each an “Affiliate”). Photos may be virtually staged or digitally enhanced and may not reflect actual property conditions. No guarantee, warranty or representation of any kind is made regarding the completeness or accuracy of descriptions or measurements (including square footage measurements and property condition), such should be independently verified, and Compass expressly disclaims any liability in connection therewith. Select the other window that you want to use in Split View mode, and it will expand to fill the void, completing the Split View experience. You’ll see the first app on one half of the screen, with thumbnails of any other open windows on the other side. Step 3: One half of your Split View is done. Select either the second or third option, and the window will fill that portion of your display. Hold down on this Green Dot, and a list of options appears: Enter Full Screen, Tile Window to Left of Screen, and Tile Window to Right of Screen. Step 2: If you hover the cursor over the Green Dot, it presents two small “expand” arrows. ![]() Pick your first window, and look in its upper-left corner to find three colored dots: Red, yellow, and green. Step 1: Begin by opening two or more windows that you want to be paired in a split-screen layout: Browser windows, apps, documents - whatever you want. ![]() Just remember, record as big as possible, then edit in smaller dimensions, and keep in mind where this video will be displayed.Ĭan’t see the embedded video? Watch it on YouTube.Įditor’s Note: This post was originally published in June 2015 and has since been updated for accuracy and comprehensiveness. I know this is a lot to cover and can be confusing at first, but once you start practicing and experimenting for yourself, it will start to make sense. So when you can, convert your footage to. Plus, almost all web and software applications accept this as a universal format and they play well on almost all devices. This ensures a high quality video, at a low file size. MP4 file format (or H.264) whenever possible. My main piece of advice is try and use the. This topic can get very confusing very quickly. Step 3: Know your file formatsįinally, the last topic I want to cover is file formats. Just make sure if you’re using graphics in your video that they are able to scale without creating a blurred video. You can find stock image and video sites that offer both for sale. You also see this in applications like Photoshop, Illustrator or After Effects which base a lot of their editing techniques on vector art. If you are a Camtasia or Snagit user, you may have noticed that some callouts are in vector form, they can be scaled without losing quality. Vector art does not use pixels, so they are resolution-independent. In other words, raster art cannot be enlarged without losing quality. Raster art is made of a certain number of pixels and vector art is based on mathematical calculations. The second set of terms I want to cover are vector art vs. Step 2: Choose vector art for your videos If you do record in those higher dimensions, you will end up with very large files, and this will slow down your computer dramatically. But unless you have a very powerful computer, I would recommend 1080p to get started. Nowadays, there are ultra high definition monitors. ĭepending on the content, you can get away with scaling or zooming slightly larger than 100 percent. Your footage becomes blurry when you zoom in or scale footage larger than what you originally recorded at. The reason we record in a higher dimension is because when we edit video it gives us flexibility in zooming and scaling footage. So when we record, we set our screen dimensions to 1080p - not 720p. But whatever screen resolution you have available, always try and record in the highest resolution possible.Īt TechSmith, we usually export videos to 720p for YouTube and our website. ![]() High definition editing and production dimensions are 1080p (1920 x 1080 pixels) and 720p (1280 x 720 pixels). Screen resolution is the dimensions of your screen, most commonly measured in pixels. You always need to be familiar with what resolution you are shooting with and delivering to. What resolution is my computer screen or camera?.When your record your screen, you always want to keep the end in mind.īefore you even click the record button on your screen recorder or camera, ask yourself two questions: ![]() There are few steps to get a clear video. I’ll cover a few reasons why you may have a blurry video, and also some terms that may help you understand what exactly is going on. In this post I’m going to show you EXACTLY how to fix a blurry video.īecause the reality is, nobody likes to see a blurry or shaky video. So, get ready to find and buy all your desirable products from your best-loved brands on Ubuy. ![]() Intelex Warmies Intelex Cozy Plush Fully Microwavable Toy: Monkey. Searching for your preferred products and brands across towns and cities may not be necessary for this modern technological era since your products are just one click away. Snuggle up at bedtime with Cozy Plush monkey lavender scented microwavable toy hell keep you cosy & warm for up to 2 hours & help encourage a good night’s sleep. You can discover the latest offers on Intelex products and save money each time you decide to purchase. To find a perfect collection of unique and popular global products from Intelex, Ubuy online shopping can help you to get the right product that suits your specific requirements. It is also the right place to find products that are not easily available elsewhere. If you are looking for exclusive Intelex products online in Victoria, Anse Boileau, Bel Ombre, Beau Vallon, Cascade, Anse Royale, Takamaka, Port Gloud, etc you can find it effortlessly on Ubuy which is a one-stop-shop to explore from over 100 million products and brands from international market. A good online store is a quintessential stop to discover a galaxy of brands and products to suit every requirement. Hence, it is very essential and beneficial to find a genuine, reliable and trustworthy online store to buy Intelex products. Most people would love to find all their essential products in one location, whenever they choose to buy anything. įor press enquiries contact Keri Williams on 44 (0)1 ext 4.If you are looking for all the best international brands and genuine quality global products, your search ends here. More information about Intelex is available from.Intelex is responsible for the invention of three world ‘firsts’: the first fully microwavable herbal heat pack to be sold in Europe, the first fully microwavable soft toy, and the first fully microwavable slipper.Intelex is based in Northamptonshire and supplies to more than 30,000 retailers worldwide.Intelex Group was founded in 1995 in London to commercialise a new, innovative way of relieving everyday aches and pains.You can also buy them direct from Intelex Group at. Warmies® are available to buy from more than 8,000 retailers nationwide, including Sainsbury’s, New Look and Debenhams. They are also gently scented with French lavender, helping provide soothing comfort at bedtime. Warmies® are fully microwavable and ready for use after just 90 seconds in the microwave. They’re perfect stocking filler ideas.”Įarly reception to the new Warmies® has been extremely positive, and the four characters are tipped to become firm favourites with children this Christmas. And since Warmies® are great for soothing aches and pains, it means they’ll go down well with adults too. ![]() Children are going to love the Snowman and Penguin, with their little Christmas hats and scarves. “At just £11.95, these soft and fluffy characters are fun toys by day, and snug sleeping companions by night. “A Dragon, Penguin, Snowman and Reindeer are the newest members of the Warmies® family,” says Gary Savage, General Manager of Intelex Group. Now Intelex’s troupe of fully heatable soft toys has been joined by some new friends, courtesy of Intelex’s in-house creative design team. They are also the creative minds behind the world’s first ever and original Warmies® microwavable soft toy, ‘Beddy-Bear. Intelex are the innovators behind the bestselling Hot Pak®, the first ever fully microwavable heat pack to be sold in Europe. Intelex Group have added some festive new characters to their popular Warmies® range of heated soft toys, just in time for Christmas. ![]() ![]() Scaffolding was facilitated using a directed graph containing scaffolds longer than 200 bp as nodes, and edges were based on the PE and MP links as vertices. The mapping of the single read ends (mapping without gaps) and long-read builds facilitated scaffolding by linking contigs mapping to the same read. To scaffold the contigs of the De Bruijn graph, non-repetitive contigs within the graph were identified and assembled into scaffolds based on mapping information of the single end reads, followed by application of synthetic long-reads to resolve long repeats in a similar way. A kmer of size 63 bp was optimal for De Bruijn graph construction. In the first step of assembly, SOAPdenovo v1.05 (Luo et al., 2012) was used to construct a De Bruijn graph of contigs from the single end reads of the PE library using very conservative settings (no bubble merge and no repeat masking, but removing low coverage kmers and edges). The TruSeq synthetic long-read assembly pipeline application was processed by Illumina (Illumina IGN FastTrack Long Reads version 41 Illumina, San Diego, CA) to create synthetic long-read builds that represent long contiguous template fragments. Mate-pairs that did not hit the linker were used only in support of links found with the filtered MPs, but were not used to create links independently. Mate pairs for which the linker was not found were sorted into a separate file for restricted scaffolding application. Processing of MP reads consisted of filtering out putative false mate-pairs by searching for the Nextera linker (10 nucleotides of CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG) sequence on either end of the MP. For the PCR-free library (MiSeq stitched reads), following adaptor truncation, overlapping reads were merged using FLASH (Magoc and Salzberg, 2011) with a minimal required overlap of 10 bp to create the stitched reads. The Illumina HiSeq2000 adaptor AGATCGGAAGAGC was removed, and reads were error corrected using the Corrector_HA module of SOAPdenovo (using kmer size 23 and cutoff of 6) (Luo et al., 2012). For all PH207 genomic libraries, with the exception of TruSeq synthetic long-reads, PCR duplicates were removed using FastUniq software (Xu et al., 2012). Sequencing method: Illumina HiSeq ChemistryĪssembly methods: Reads pre-processing and error correction. Sequencing technologies: Whole-genome shotgun sequencing using paired-end, mate-pair, and TruSeq synthetic long-reads MikelĭOE Great Lakes Bioenergy Research Center (DOE BER Office of Science DE-FC02-07ER64494), by Dow AgroSciences, and by the National Science Foundation (Grant IOS-1126998 to K.L.C.).ĭe novo assembly of elite inbred line PH207 provides insights into genomic and transcriptomic diversity in maize (Zea mays L.). Bowman, Ilya Soifer, Omer Barad, Doron Shem-Tov, Kobi Baruch, Fei Lu, Alvaro G. To learn about maize genome and gene model nomenclature rules.Ĭandice N. Information about assembly Zm-PH207-REFERENCE_NS-UIUC_UMN-1.0 ![]() Hotel offering confidential documents to top Israeli military officials. Then a Senate Foreign Relations Committee staffer, was overheard in a DC That Israeli agents apparently tried to steal Recon Optical Inc’s In 1992, the Wall Street Journal reported.Journal headline: “Role of Israel in Iran-Contra Scandal Won’t be Explored Intelligence operatives being run directly by the government. National Counter Intelligence Directorate "industrialĮspionage-people coming over here on trade missions or with IsraeliĬompanies working in collaboration with American Companies, or This has been verified by U.S.ĭepartment of Homeland Security, The State Department, The FBI and the Newsweek dated 2014 the Israeli Espionage goal is also America's Technology to China Dec 2013 Defense Tech News This combo will require Preparation or The Coin to pull off, however.Denials Contradicted by Secret NSA Documents Has extreme combo potential with Tak Nozwhisker, who will add those 1-cost cards directly to your hand at the same time. Furthermore, the cards being set to 1 mana lets Valeera the Hollow duplicate high-value cards. The large number of cards generated also allows Tess Greymane to generate immense value if the opponent is playing a different class. ![]() Miracle Rogue decks also make good use out of this card since drawing a 1-cost spell will continue the chain of card draws. This card has strong synergy with Myra's Unstable Element, guaranteeing you draw the cards shuffled in. Players can play around this by waiting until the priest has played Benedictus or be sure that the priest does not have him before playing Academic Espionage. When playing against priests, especially Control Priests, players should note that Archbishop Benedictus can copy all shuffled cards and gain immense value, effectively negating the positive affect of Academic Espionage, and potentially even harm the rogue, by providing the cards to both players, while priests can utilize priest cards much better than rogues. On the other hand, if you are relying on this card, then drawing regular cards from your deck can be a dud, just like Queen Carnassa. The amount of cards it adds dilutes your deck, so if you are relying on card combos or topdecking certain cards, this decreases the chances of drawing the cards you need. While the potential to high-roll with this card is very strong, there are a few downsides. Lastly, this game-changing card can potentially be used on turn 1 with the use of Preparation. Rogues already have strong card-draw, so cards like Elven Minstrel and Sprint can help give a large hand of cheap and potentially very powerful spells and monsters from your opponent's class. In addition to providing extra copies of the cards shuffled, Augmented Elekk also allows its users to see which cards were shuffled into the deck, this can be done by simply viewing the history bar or by using an external deck-tracking software. When 2 are used and their effects doubled by an Augmented Elekk or by Valeera the Hollow, it can potentially provide an absurd 40 extra 1-cost cards. There is however always the possibility of gaining weak, low-cost cards like Whirlwind or Zap! instead. As you shuffle 10 total cards into your deck, the odds are that at least a few will be strong cards that now only cost 1 mana, such as Pyroblast, Lord Godfrey, or even Hero Cards like Shadowreaper Anduin. Academic Espionage is an extremely powerful card that can practically win a game on its own with no drawbacks (as long as you're not terribly unlucky). Photo(s) of the Body Part designated for your Tattoo - See attached images (1-3), ruler/measuring tape visible in picture 3 Size of desired tattoo - 8”x7”/ largest possible space, willing to extend across chest No exceptions.Ĭlient Availability: Monday-Saturday 12-8, Sunday 12-6įull Content - Dark/Gothic style unicorns in clouds: 3-5 Black unicorns with red eyes and pink horns/hooves, riding gray clouds with lightning underneath and “blood” rain, open to changes or ideasĬolor or Black & Gray - Color, lots of reds/pinks/yellowsīody Part / Size of Body Part - Right side of chest, 8" from collarbone to nipple, 7" from sternum to arm, willing to extend across chest No shows will result in the forfeit of your deposit. If your tattoo request is better suited for a Walk-In, you will be redirected to do so.Ĭancelations within 24 hours of your appointment will result in the forfeit of your deposit. If your tattoo request is better suited for another artist, you will be redirected to them. If this form is not filled out correctly in its entirety and/or there are no attached references, then you will not receive a response. You have read the entirety of our COVID-19 regulations. Two or more References for your Tattoo Design (images, drawings, other tattoos, etc.)ĭo you acknowledge, understand and to agree the following: (Yes or No) Photo(s) of the Body Part designated for your Tattoo (No selfies or mirror pictures) If you would like to book with Lorelei, you can do so via this form and her contact information.Ĭlient Availability: (DO NOT write “any time,” “no preference,” etc.)īody Part / Estimated Size of Body Part. If you would like to book with Amanda Lee, you can do so via her contact information. If you would like to book with Lou, you can do so via his website: On Fridays and Saturdays, we open at 12:00 pm and close at 10:00 pm.If you would like to book with Swift, you can do so via his website: /book Our hours are 12:00pm until 9:00pm Sunday through Thursday. If you'd like more information about our shops and our work, pay us a visit. We are top in the area among tattoo and piercing parlors. We are one of the greatest ‘tattoo shops near me’ you've been seeking. Whatever type of tattoo you want, we can do it for you. Every technician working for us is CAL-OSHA certified, and any equipment we use has a lifespan of one usage before it's discarded. ![]() When you are near the best, why run around looking for someone to give you great tattoos and body piercings when one of the best is among the ‘tattoo shops near me’? We use state-of-the-art equipment and diligent sterilization methods to make sure you're protected and safe when you work with us. We hold our own position among other tattoo and piercing parlors around the area and stand apart as one of the top parlors in the area. We have a passion for tattoo art and piercings, which is one reason why we're so good at it. Appointments are recommended to make sure you do not waste any time when you visit us. If you're looking for the who's who among tattoo and piercing parlors, we're the place to go.Īt Grand Avenue Tattoo & Piercing, we take both appointments and walk-ins. Our reputation is solid and our work exceptional. We have pages of glowing testimonials from our satisfied customers. We're an established parlor and have been delivering high-quality tattoos and piercings to the Phoenix, AZ area which includes the cities of Scottsdale, Tempe, and Chandler among others for the past seven years. We are highly skilled and talented artists specializing in all kinds of tattoos and body piercings. ![]() Want to know the best tattoo and piercing parlors in the greater Phoenix, AZ area or looking for tattoo shops near me? The answer to both questions is the Grand Avenue Tattoo & Piercing. Best Text Scanner - Support screenshot OCR.In the eventuality that users are creating tutorials on troubleshooting or similar topics where both visual and written instructions would come in handy, then Easy Screen OCR can help users grab screenshots as well as extract the relevant text from these images or PDF files. While it is true that users can expect high recognition accuracy, it is important that check their network and ensure the computer works on a stable connection. It is worth mentioning that the OCR operation is performed in the cloud and it is powered by Google OCR. It goes without saying that you can copy the text to the clipboard or anywhere else and edit it accordingly. The program is as simple to use as it looks, meaning that once the user grabs the capture, it can extract the text with just one click. ![]() Quite simple to use and it deserves giving a shot. It is a smart application to help users to capture the screenshot and then extract the text from these pictures in the most efficient way. In that case, ApowerPDF best fits since it has everything you need in PDF software.Easy Screen OCR is an easy and simple PC screenshot OCR and translation application. ![]() While on the other hand, use a paid version if you want an advanced OCR function and other PDF tools. If you want to save money, you can use the free tools. Here, we listed both paid and free tools that you can utilize depending on your needs. Furthermore, it supports multiple languages including English, Italian, German, Spanish, French, Portuguese, Dutch, and so on.Īs shown above, these are the best OCR software that you must try. ![]() In that case, you can conveniently scan documents and turn them into an editable format. This is a handy tool that can be used to extract text from image files. Last OCR program recommened is Boxxoft Free OCR. Apart from that, if you have several files that need to be converted, you can use its batch OCR function. With this tool, you can accurately convert the document into an editable format. With it, you can scan without experiencing any delay. It is completely compatible with Windows 7, 8, Vista and XP.Īnother free tool is SimpleOCR. Aside from that, it uses the latest Tesseract OCR engine which recognizes more than 100 languages. This software includes a convenient Windows installer. You can use the hotkey “Windows Key + Q” to capture the screen easily. Furthermore, it is very easy to use since users just need to screenshot the part they wish to convert and then copy the text after. With this OCR program, users just need to press the Windows key + Q to OCR capture. This is one of the best OCR software programs great for extracting text from image files conveniently. Second, it only allows you to upload files of up to 15MB. Two things you should note however, it enables you to convert 15 files per hour without requiring you any registration with its guest mode. As its name implies, this a free online OCR tool that can be used on most of the browsers. Apart from that, it supports saving files as several output formats.Īn alternative OCR program that can extract text from the PDF and images to convert it into an editable file is Free Online OCR. Furthermore, it is capable of recognizing text from multiple PDF files with its batch processing feature. This software enables you to change the text from the scanned images without causing any trouble. Readiris is an OCR solution that can be utilized on Windows. If you need to convert scanned PDF to editable formats with Android, please read this article. Besides that, the documents can be stored in the cloud for up to 14 days. Moreover, it can recognize texts from more than 190 languages from scans and photos. ![]() In that case, you can work with your PDFs using your desktop or laptop. It offers both online and desktop versions. Other OCR Software to Extract Text from Scanned PDFĪBBYY is an OCR software for Windows 10 that can recognize characters from the PDF file. In just a few clicks, your PDF file will be editable. Aside from that, users can change the page range wherein they can choose all pages or pick pages that want to convert. Moreover, it supports numerous languages such as English, French, German, Italian, Korean, Japanese and so on. This is a PDF tool offering the OCR function allowing you to scan PDF files and convert them to an editable format. An Easy-to-use OCR Program - ApowerPDF Downloadįirst and foremost, we recommend ApowerPDF. ![]() ![]() Naked Lunch is a groundbreaking achievement. Burroughs doesn’t bend to censorship to make the book more palatable for sales or for critical reviews. Historically, it’s also worth admiring his complete disregard for mainstream sensibility. It was taken from the greek word U for no and the Greek word for where. From the content to the form and style, he lives up to that intention. Utopia was written by Sir Thomas More in 1516, who coined the word. in the real world of Utopia, Thomas Mores pen has written even more, while. The meaning of the title as Burroughs explains it is to bare the naked truth of reality on the end of a fork. meanings or its exact nature.1 More could not have written Utopia at a. Like the book or not, it shakes you into realizing that there are possibilities beyond the conventional.īurrough’s language is honed to a razor’s edge, and I find that many of the sentences in Naked Lunch burn like fire. The disorder thematically represents the chaos of existence and the universe, and it also disrupts the reader. Burroughs invented a technique called the “cut-up method,” where he cut up his coherent storyline into paragraphs, scenes, and even sentences, then reordered them both randomly and editorially. Who wrote Utopia in 1516 Thomas More William Shakespeare Christopher Marlowe Francis Bacon. In effect, it becomes more than a work of fiction, it becomes an experience. Both in content and structure, Naked Lunch is powerful and wholly original. First published in 1959, Naked Lunch was shocking then, and it still retains its power today. When More wrote Utopia in the early sixteenth century he was not the first writer to have imagined a better world. This activity includes fraction word problems and number problems with mixed numbers, unlike denominators, etc. It has both printable and digital options for a fractions review (or quiz!) that covers all fraction operations. If you're looking for a more traditional review for operations with fractions, you can download this free quiz instead, or use it as a follow up to the whole class review game.
|
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |